Important
This repository is deprecated and no longer maintained. Development continues at RNABioInfo/RNAnue. Checkout the develop branch for the latest updates.
RNAnue is a comprehensive analysis to detect RNA-RNA interactions from Direct-Duplex-Detection (DDD) data.
RNAnue has the following dependencies, whereas the brackets indicate the version RNAnue has been build and tested on. Make sure the requirements are satified by your system. cmake is able to detect the Boost libraries system-wide. However, Seqan3 is expected to be located in the current folder of RNAnue as specified in the CMakeLists.txt. Segemehl and the Vienna binaries need to be located in $PATH.
- Boost C++ Libraries (v1.72.x)
- SeqAn (v3.3.0)
- Segemehl (v0.3.4)
- Vienna Package (>= v2.4.17)
RNAnue is build using CMake. At first, clone the repository and change into the source directory.
git clone https://github.com/Ibvt/RNAnue.git
cd RNAnue
In the next step, retrieve the SeqAn library and place it in the root folder of RNAnue. CMake is a cross-platform Makefile generator. For that, we provide the CMakeLists to simplify the build process. In particular, it utilizes the instructions given in the CMakeLists. It is recommended to create a "out-of-source build". For that, create a build folder (e.g., ./bin) and cmake into the root directory.
cmake ../source/
This is be sufficient if the dependencies are located in $PATH. Calling make builds RNAnue.
RNAnue provides different functional arguments (subcalls) for individual procedures. These include RNAnue preproc,
RNAnue align, RNAnue clustering, RNAnue analysis. In additon, RNAnue complete applies the whole workflow.
RNAnue requires the sequencing files to be in a specific folder structure. The root folders of the treatments (--trtms) and controls (--ctrls) are specified accordingly. These folders contain subfolders with arbitrary conditions (e.g., treatment, cell lines,...) that in turn contain the read files, e.g.,
./trtms/
condition1
condition2
./ctrls
condition1
condition2
It is to be noted that the --trtms needs to be specified. However, --ctrls may be not set (optional).
RNAnue accepts parameter settings both from the commandline and through a configuration file. For the latter, we provide a template configuration file (params.cfg) that allows to set the parameters in a more convenient fashion. This means that the call of RNAnue is reduced to the following call.
RNAnue <subcall> --config /path/to/params.cfg
Here, subcall corresponds to positional arguments.In any case, the specifying parameters over the command lines has precedence over the config file.
In principle, the results of the analysis are stored in the specified output folder and its subfolders (e.g., ./preproc, ./align, ./clustering, ./analysis). RNAnue reports the split reads in SAM format, the clusters and the RNA-RNA interactions. RNAnue reports the split reads in SAM format. Additionally, the complementarity scores and hybridization energies are stored in the tags FC and FE, respectively. We report the clusters in a custom format that includes the IDs of the clusters, its length, size and genomic coordinates.
RNAnue reports the detected splits in .SAM format (RNAnue detect). In this file, pairs of rows represent the
split reads, consisting of the individual segments, e.g
A00551:29:H73LYDSXX:1:1101:7274:10645 16 gi|170079663|ref|NC_010473.1| 3520484 22 1X51= * 0 0 AGGGGTCTTTCCGTCTTGCCGCGGGTACACTGCATCTTCACAGCGAGTTCAA * XA:Z:TTTCTGG XC:f:0.714286 XE:f:-15.6 XL:i:7 XM:i:5 XN:i:0 XR:f:0.0735294 XS:i:5 XX:i:1 XY:i:52
A00551:29:H73LYDSXX:1:1101:7274:10645 16 gi|170079663|ref|NC_010473.1| 3520662 22 11=5S * 0 0 TTCGATCAAGAAGAAC * XA:Z:GAAGAAC XC:f:0.714286 XE:f:-15.6 XL:i:7 XM:i:5 XN:i:0 XR:f:0.0735294 XS:i:5 XX:i:53 XY:i:68
In the following the tags are listed that are reported in the detected split reads. Please note that in the upper segment the alignment is in reverse as done in the calculation of the complemtarity to represent the 3-5 and 5-3 duplex.
| tag | description |
|---|---|
| XC:f | complementarity |
| XL:f | length of alignment |
| XS:i | alignment score |
| XM:i | matches in alignment |
| XR:f | site length ratio |
| XA:Z | alignment of sequence |
| XE:f | hybridization energy |
| XD:f | MFE structure in dot-bracket notation |
The clustering procedure reports a single clusters.tab file which is a tab-delimited file of the clustering results.
Here, each line represents a cluster that corresponds to overlapping split reads, defined by the two segments. The
columns are defined in the following:
| Field | Description |
|---|---|
| clustID | Unique identifier of the cluster |
| fst_seg_chr | Chromosome (accession) of the first segment |
| fst_seg_strd | Strand where the first segment is located |
| fst_seg_strt | Start position of the first segment in the cluster |
| fst_seg_end | End position of the first segment in the cluster |
| sec_seg_chr | Chromosome (accession) of the second segment |
| sec_seg_strd | Strand where the second segment is located |
| sec_seg_strt | Start position of the second segment in the cluster |
| sec_seg_end | End position of the second segment in the cluster |
| no_splits | Number of split reads in the cluster |
| fst_seg_len | Length of the first segment |
| sec_seg_len | Length of the second segment |
The analysis procedure generates _interactions files for each library in which each line represents an annotated
split read that is mapped to a transcript interaction. The fields are defined as follows:
| Field | Description |
|---|---|
| qname | read/template identifier |
| fst_seg_strd | Strand where the first segment is located |
| fst_seg_strt | Start position of the first segment |
| fst_seg_end | End position of the first segment |
| fst_seg_ref | Reference name of the first segment corresponding to the seqid in GFF and/or clusterID |
| fst_seg_name | Name of the first segment that corresponds to gene name/symbol and/or clusterID |
| first_seg_bt | Biotype of the annotation transcript (if available) |
| fst_seg_anno_strd | Strand information of the transcript in the overlapping annotation |
| fst_seg_prod | Description of the transcript (if available in annotation) |
| fst_seg_ori | Orientation of the segment with respect to annotation (sense/antisense) |
| sec_seg_strd | Strand where the second segment is located |
| sec_seg_strt | Start position of the second segment |
| sec_seg_end | End position of the second segment |
| sec_seg_ref | Reference name of the second segment corresponding to the seqid in GFF and/or clusterID |
| sec_seg_name | Name of the second segment that corresponds to gene name/symbol and/or clusterID |
| sec_seg_bt | Biotype of the annotation transcript (if available) |
| sec_seg_anno_strd | Strand information of the transcript in the overlapping annotation |
| sec_seg_prod | Description of the transcript (if available in annotation) |
| sec_seg_ori | Orientation of the segment with respect to annotation (sense/antisense) |
| cmpl | Complementarity score of the interaction |
| fst_seg_compl_aln | Alignment results in the complementarity calculation of the first segment |
| sec_seg_cmpl_aln | Alignment results in the complementarity calculation of the second segment |
| mfe | Hybridisation energy of the interaction |
| mfe_struc | Minimum free energy (MFE) structure of interaction in dot-bracket notation |
The main result of an RNAnue analysis are transcript interactions. They are stored in the file allints.txt in the
same directory. Its entries are structured as described in the following where columns with prefix are given
for each sample specified in the analysis (within the same file).
| Field | Description |
|---|---|
| fst_rna | Gene/Transcript name of the first interaction partner |
| sec_rna | Gene/Transcript name of the second interaction partner |
| fst_rna_ori | Orientation of the first interaction partner with respect to annotation (sense/antisense) |
| sec_rna_ori | Orientation of the second interaction partner with respect to annotation (sense/antisense) |
| <sample>_supp_reads | Number of (split)reads that support the interaction |
| <sample>_ges | Global energy score (gcs) of the interaction |
| <sample>_ghs | Global hybridisation score (ghs) of the interaction |
| <sample>_pval | Statistical significance (p-value) of the interaction |
| <library>_padj | Benjamini-Hochberg adjusted p-value among the samples |
If the option –outcnt is set to 1 RNAnue generates the count table counts.txt in the output directory.
It contains the counts of each interaction for each sample and can be used for differential expression
analysis. Similarly, –outjgf set to 1 generates a graph.json file that contains the detected interactions
in JSON graph format. Finally, –stats set to 1 creates a stats.txt file that contains basic statistics for
each step of the analysis.
In additon, we provide a ready-to-use Docker container that has RNAnue preconfigured.
The provided Docker container can also be used with Singularity.
singularity pull docker://cobirna/rnanue:latest
singularity exec --bind /path/to/data:/data rnanue_latest.sif RNAnue <subcall> --config /data/params.cfg
We provide a test dataset in the test folder that can be used to test the installation.
For that, test/humanSE.cfg can be used by specifying it in the --config parameter (needs to be absolute path).
RNAnue <subcall> --config /path/to/RNAnue/test/humanSE.cfg
contact cobi@ibvt.uni-stuttgart.de or create an issue
