convert alignment bam file to multiple sequence alignment(msa) file(need samtools)
$ cd test/
$ ../src/bam2msa ref.fa out.bwa.bam NC_045512.2_1bp_to_1680bp:15-43|cut -f 1-6|column -ts $'\t'|less -RS
1 2 3 4 5 6
#query_msa ref_msa consensus_msa ref_cut_region query_id r1_or_r2
CC--CCCAGGTAACAAACCAACCAACCTT CCTTCCCAGGTAACAAACCAACCAACTTT ==DD======================X== NC_045512.2_1bp_to_1680bp:15-43 clone1 se
AACCAACCAACCTT CCTTCCCAGGTAACAAACCAACCAACTTT ===========X== NC_045512.2_1bp_to_1680bp:15-43 clone2 se
## add --output-format 2
$ ../src/bam2msa ref.fa out.bwa.bam NC_045512.2_1bp_to_1680bp:15-43 --output-format 2|cut -f 1-7|column -ts $'\t'|less -RS
1 2 3 4 5 6
#seq_type id alignment consensus r1_or_r2 read_strand
ref NC_045512.2_1bp_to_1680bp:15-43 CCTTCCCAGGTAACAAACCAACCAACTTT
query clone1 CC--CCCAGGTAACAAACCAACCAACCTT ==DD======================X== se +
query clone2 AACCAACCAACCTT ===========X== se -
## colorsize snp/indel of output with --colorize-snp-indel 1
$ ../src/bam2msa ref.fa out.bwa.bam NC_045512.2_1bp_to_1680bp:15-43 --colorize-snp-indel 1 --output-format 2|cut -f 1-7|column -ts $'\t'|less -RS
$ ../src/bam2msa
Contact: ilikeorangeapple@gmail.com or go to https://github.com/orangeSi/bam2msa/issues
Usage:
bam2msa [flags...] <ref> <bam> <regions> [arg...]
convert bam to msa format for alignment file
Flags:
--colorize-snp-indel (default: 0) # colorize snp and indel of output
--display-read-boundary (default: 1) # display the read boundary, 0 mean not display
--help # Displays help for the current command.
--measure-run-time (default: 0) # measure the run time of code
--primary-only (default: 1) # only for primary alignment. 0 mean all alingment, 1 is only primary alignment
--span-whole-region-read-only (default: 0) # only for read which span the whole region. 0 mean all read which overlap with the region, 1 mean is read which span the whole region
--version # Displays the version of the current application.
Arguments:
ref (required) # ref fasta file
bam (required) # bam alignemnt file or STDIN
regions (required) # display read and ref msa alignment in these regions, example: chr1:1000-1200,chr2:2000-2300
$ cd test && cat demo.sh
set -e
./bam2msa ref.fa out.bwa.bam NC_045512.2_1bp_to_1680bp:1-1680 --span-whole-region-read-only 0 >out.bam2msa
cat out.bam2msa |grep -v '^#'|awk -F '\t' '{print ">"$4"\n"$2"\n>"$5"\n"$1}'|sed 's/:.*//' >out.bam2msa.msa
ln -sf out.bam2msa.msa case
ln -sf ../data/out.mafft.msa control
diff control case
if [ $? -eq 0 ];
then
echo "ok, test passed!"
else
echo "sorry, test failed! give a issue to me please~~~"
fi
$ sh demo.sh
ok, test passed!
samtools view data/out.bwa.bam|wasmer --dir=data/ src/bam2msa_final.wasm -- data/ref.fa STDIN NC_045512.2_1bp_to_1680bp:1-1680
